skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer /export/galaxy-central/database/files/000/dataset_7.dat /export/galaxy-central/database/files/000/dataset_8.dat -m head -r 0.1 -d 0.03 -q 0 -Q 0 -l 18 -f auto -o trim Input file: /export/galaxy-central/database/files/000/dataset_7.dat Paired file: /export/galaxy-central/database/files/000/dataset_8.dat trimmed: trim-trimmed-pair1.fastq, trim-trimmed-pair2.fastq Parameters used: -- 5' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 5' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ (auto detected) -- minimum overlap length for adapter detection (-k): 3 Fri Nov 30 01:45:28 2018 >> started Fri Nov 30 01:45:47 2018 >> done (18.214s) 250000 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 250000 (100.00%) read pairs available; of these: 10328 ( 4.13%) trimmed read pairs available after processing 239672 (95.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 29 1 0.00% 30 14 0.01% 31 27 0.01% 32 44 0.02% 33 69 0.03% 34 79 0.03% 35 116 0.05% 36 97 0.04% 37 143 0.06% 38 163 0.07% 39 160 0.06% 40 185 0.07% 41 180 0.07% 42 206 0.08% 43 203 0.08% 44 239 0.10% 45 248 0.10% 46 258 0.10% 47 295 0.12% 48 286 0.11% 49 286 0.11% 50 312 0.12% 51 349 0.14% 52 356 0.14% 53 425 0.17% 54 382 0.15% 55 385 0.15% 56 421 0.17% 57 432 0.17% 58 404 0.16% 59 462 0.18% 60 452 0.18% 61 532 0.21% 62 534 0.21% 63 537 0.21% 64 585 0.23% 65 847 0.34% 66 1165 0.47% 67 1138 0.46% 68 1273 0.51% 69 1185 0.47% 70 1340 0.54% 71 1349 0.54% 72 1392 0.56% 73 1286 0.51% 74 1324 0.53% 75 1401 0.56% 76 1371 0.55% 77 1390 0.56% 78 1480 0.59% 79 1423 0.57% 80 1445 0.58% 81 1585 0.63% 82 1561 0.62% 83 1735 0.69% 84 1809 0.72% 85 1751 0.70% 86 1877 0.75% 87 1958 0.78% 88 1862 0.74% 89 1738 0.70% 90 1853 0.74% 91 1889 0.76% 92 1981 0.79% 93 2139 0.86% 94 2367 0.95% 95 2678 1.07% 96 3093 1.24% 97 3806 1.52% 98 4875 1.95% 99 12417 4.97% 100 6641 2.66% 101 159709 63.88%