skewer v0.2.2 [April 4, 2016]
COMMAND LINE:	skewer /export/galaxy-central/database/files/000/dataset_7.dat /export/galaxy-central/database/files/000/dataset_8.dat -m head -r 0.1 -d 0.03 -q 0 -Q 0 -l 18 -f auto -o trim
Input file:	/export/galaxy-central/database/files/000/dataset_7.dat
Paired file:	/export/galaxy-central/database/files/000/dataset_8.dat
trimmed:	trim-trimmed-pair1.fastq, trim-trimmed-pair2.fastq

Parameters used:
-- 5' end adapter sequence (-x):	AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 5' end adapter sequence (-y):	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r):	0.100
-- maximum indel error ratio allowed (-d):	0.030
-- minimum read length allowed after trimming (-l):	18
-- file format (-f):		Sanger/Illumina 1.8+ FASTQ (auto detected)
-- minimum overlap length for adapter detection (-k):	3
Fri Nov 30 05:16:05 2018 >> started

Fri Nov 30 05:16:25 2018 >> done (19.623s)
250000 read pairs processed; of these:
     0 ( 0.00%) short read pairs filtered out after trimming by size control
     0 ( 0.00%) empty read pairs filtered out after trimming by size control
250000 (100.00%) read pairs available; of these:
 10328 ( 4.13%) trimmed read pairs available after processing
239672 (95.87%) untrimmed read pairs available after processing

Length distribution of reads after trimming:
length	count	percentage
 29	     1	  0.00%
 30	    14	  0.01%
 31	    27	  0.01%
 32	    44	  0.02%
 33	    69	  0.03%
 34	    79	  0.03%
 35	   116	  0.05%
 36	    97	  0.04%
 37	   143	  0.06%
 38	   163	  0.07%
 39	   160	  0.06%
 40	   185	  0.07%
 41	   180	  0.07%
 42	   206	  0.08%
 43	   203	  0.08%
 44	   239	  0.10%
 45	   248	  0.10%
 46	   258	  0.10%
 47	   295	  0.12%
 48	   286	  0.11%
 49	   286	  0.11%
 50	   312	  0.12%
 51	   349	  0.14%
 52	   356	  0.14%
 53	   425	  0.17%
 54	   382	  0.15%
 55	   385	  0.15%
 56	   421	  0.17%
 57	   432	  0.17%
 58	   404	  0.16%
 59	   462	  0.18%
 60	   452	  0.18%
 61	   532	  0.21%
 62	   534	  0.21%
 63	   537	  0.21%
 64	   585	  0.23%
 65	   847	  0.34%
 66	  1165	  0.47%
 67	  1138	  0.46%
 68	  1273	  0.51%
 69	  1185	  0.47%
 70	  1340	  0.54%
 71	  1349	  0.54%
 72	  1392	  0.56%
 73	  1286	  0.51%
 74	  1324	  0.53%
 75	  1401	  0.56%
 76	  1371	  0.55%
 77	  1390	  0.56%
 78	  1480	  0.59%
 79	  1423	  0.57%
 80	  1445	  0.58%
 81	  1585	  0.63%
 82	  1561	  0.62%
 83	  1735	  0.69%
 84	  1809	  0.72%
 85	  1751	  0.70%
 86	  1877	  0.75%
 87	  1958	  0.78%
 88	  1862	  0.74%
 89	  1738	  0.70%
 90	  1853	  0.74%
 91	  1889	  0.76%
 92	  1981	  0.79%
 93	  2139	  0.86%
 94	  2367	  0.95%
 95	  2678	  1.07%
 96	  3093	  1.24%
 97	  3806	  1.52%
 98	  4875	  1.95%
 99	 12417	  4.97%
100	  6641	  2.66%
101	159709	 63.88%